Step 1: Choose classifier

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)

Multinomial logistic regression

Genetic distance algorithm (allele and genotype frequency versions)

Step 2: Data input

Type 10 markers of the individual to classify as appropriate. For instance, the following 10 marker profile would be valid:

GGGCGGAAAACCAACCAAGC

Bases can be upper or lowercase. Blanks will be removed. Uncalled alleles must be entered as n or N.