Binary AIM classification of individuals as Europe-East Asia-Africa-America-Oceania (34 SNPs or 46 AIM-Indels or both)
Step 1: Choose one of the avaliable marker panels
34-plex (previous) with rs727811.
34-plex (revised) with rs3827760.
46-plex AIM-Indels.
80-plex AIM-Indels (all of the above).
Step 2: Choose populations
3 populations (Europe, East Asia, Africa).
4 populations (Europe, East Asia, Africa, America).
5 populations (Europe, East Asia, Africa, America, Oceania).
Step 3: Choose classifier
Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)
Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)
Multinomial logistic regression
Genetic distance algorithm (allele and genotype frequency versions)
Step 4: Data input
Type either 34 SNPs or/and 46 AIM-Indels of the individual to classify as appropriate. For the required SNP/Indel (rs) numbers and lists, consult the marker panels page. For instance, the following 34 SNP profile (Europe) would be valid in the case of 34-plex (previous) with rs727811, and 3 populations:
AAAACTGGCCAATTCCAACCCCAGTTGGAAAAAGCCTTTTGGTTCCCTCGCCAGACTTCCCTGTCCAG
CCACCCCCAACCCCCCCCAACCCCCCACCCACAAAACCCCAACCAAACCCCCCCCCCCCCAAAAAAACCCAACCACACCCCCCCACAACCAC
34 SNPs or/and 46 AIM-Indels for each individual as makes sense, 68 or 92 or 160 bases upper or lowercase.
Blanks will be removed. Uncalled nucleotides must be entered as n or N.