USC The Snipper 4
app suite

Binary AIM classification of individuals as
Europe-East Asia-Africa-America-Oceania (34 SNPs or 46 AIM-Indels or both)


Step 1: Choose one of the avaliable marker panels

34-plex (previous) with rs727811.

34-plex (revised) with rs3827760.

46-plex AIM-Indels.

80-plex AIM-Indels (all of the above).

Step 2: Choose populations

3 populations (Europe, East Asia, Africa).

4 populations (Europe, East Asia, Africa, America).

5 populations (Europe, East Asia, Africa, America, Oceania).

Step 3: Choose classifier

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)

Multinomial logistic regression

Genetic distance algorithm (allele and genotype frequency versions)

Step 4: Data input

Type either 34 SNPs or/and 46 AIM-Indels of the individual to classify as appropriate. For the required SNP/Indel (rs) numbers and lists, consult the marker panels page. For instance, the following 34 SNP profile (Europe) would be valid in the case of 34-plex (previous) with rs727811, and 3 populations:

AAAACTGGCCAATTCCAACCCCAGTTGGAAAAAGCCTTTTGGTTCCCTCGCCAGACTTCCCTGTCCAG

and the following 46 AIM-Indel profile (Africa) would also be valid in the case of 4 populations:

CCACCCCCAACCCCCCCCAACCCCCCACCCACAAAACCCCAACCAAACCCCCCCCCCCCCAAAAAAACCCAACCACACCCCCCCACAACCAC

34 SNPs or/and 46 AIM-Indels for each individual as makes sense, 68 or 92 or 160 bases upper or lowercase.

Blanks will be removed. Uncalled nucleotides must be entered as n or N.



BBEdit The ASF HTML5 php 8 CSS R language Apple Inc.