Euro-E Asia-Africa-America-Oceania classifier

The Snipper 4
app suite

Home
Snipper papers
Reference set tools
Europe-East Asia-Africa-America-Oceania classification Black-intermediate-white skin classification Fair-dark or red-blond-brown-black hair classification Blue-greenhazel-brown eye classification 32 STR classification Europe-East Asia-Africa-America-Oceania Marker Panels Skin, Hair and Eye Marker Panels Download forensic MPS AIMs Panel Reference Population Sets
Custom set tools
Single profile classification Multiple profile classification Single profile haplotype classification Multiple profile haplotype classification Multiple profile general classification Classification using frequencies Population data analysis Offline tools Training/testing set design Snipper↔STRUCTURE file converter
Age tools
Blood, 7 CpGs, EpiTYPER (18-104 years) Blood, 7 CpGs, EpiTYPER (2-104 years) Semen, 3 CpGs, SNaPshot Tissue combined (blood & buccal & saliva), 5 CpGs, SNaPshot Blood, 5 CpGs, SNaPshot Buccal swab, 5 CpGs, SNaPshot Saliva, 5 CpGs, SNaPshot Saliva/Buccal swab, 7 CpGs, SNaPshot Cartilage, 3 CpGs, MiSeq
Tissue tool
Help
Snipper manual Excel input file generator Profile generator
About

Binary AIM classification of individuals as
Europe-East Asia-Africa-America-Oceania (34 SNPs or 46 AIM-Indels or both)

Step 1: Choose one of the avaliable marker panels

34-plex (previous) with rs727811.

34-plex (revised) with rs3827760.

46-plex AIM-Indels.

80-plex AIM-Indels (all of the above).

Step 2: Choose populations

3 populations (Europe, East Asia, Africa).

4 populations (Europe, East Asia, Africa, America).

5 populations (Europe, East Asia, Africa, America, Oceania).

Step 3: Choose classifier

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)

Multinomial logistic regression

Genetic distance algorithm (allele and genotype frequency versions)

Step 4: Data input

Type either 34 SNPs or/and 46 AIM-Indels of the individual to classify as appropriate. For the required SNP/Indel (rs) numbers, see graphics on left. For instance, the following 34 SNP profile would be valid in the case of 34-plex (previous) with rs727811, and 3 populations:

AAAACTGGCCAATTCCAACCCCAGTTGGAAAAAGCCTTTTGGTTCCCTCGCCAGACTTCCCTGTCCAG

and the following 46 AIM-Indel profile would also be valid in the case of 4 populations:

CCACCCCCAACCCCCCCCAACCCCCCACCCACAAAACCCCAACCAAACCCCCCCCCCCCCAAAAAAACCCAACCACACCCCCCCACAACCAC

34 SNPs or/and 46 AIM-Indels for each individual as makes sense, 68 or 92 or 160 bases upper or lowercase.

Blanks will be removed. Uncalled nucleotides must be entered as n or N.