Custom classification

Home
Snipper papers
Reference set tools
Europe-East Asia-Africa-America-Oceania classification Black-intermediate-white skin classification Fair-dark or red-blond-brown-black hair classification Blue-greenhazel-brown eye classification 32 STR classification Europe-East Asia-Africa-America-Oceania Marker Panels Skin, Hair and Eye Marker Panels Download forensic MPS AIMs Panel Reference Population Sets
Custom set tools
Single profile classification Multiple profile classification Single profile haplotype classification Multiple profile haplotype classification Multiple profile general classification Classification using frequencies Population data analysis Offline tools Training/testing set design Snipper↔STRUCTURE file converter
Age tools
Blood, 7 CpGs, EpiTYPER (18-104 years) Blood, 7 CpGs, EpiTYPER (2-104 years) Semen, 3 CpGs, SNaPshot Tissue combined (blood & buccal & saliva), 5 CpGs, SNaPshot Blood, 5 CpGs, SNaPshot Buccal swab, 5 CpGs, SNaPshot Saliva, 5 CpGs, SNaPshot Saliva/Buccal swab, 7 CpGs, SNaPshot Cartilage, 3 CpGs, MiSeq
Tissue tool
Help
Snipper manual Excel input file generator Profile generator
About

AIM classification of individuals
with an Excel file of populations (.xlsx format)

Step 1: Data input (population)

Drag and drop on the button, or select the local Excel population file to upload, whichever suits you best (training-set-only file is required). You can download a valid example file if necessary to clarify ideas, or use the input file generator wizard.

Step 2: Choose classifier

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)

Multinomial logistic regression

Genetic distance algorithm (allele and genotype frequency versions)

Step 3: Data input (individual)

Type the markers of the individual to classify in the area below. For instance, in the case of 32 SNPs we would expect you to type 64 bases upper or lowercase, something in the neighbourhood of

TTCCCTTTGGAACCCCAATTAAAATTCCAATTAACCAGGGCCAACCAAGGATCCATAGTTCCAC

Another example: in the case of the above Excel example file snipperfile.xlsx, we would expect you to type 24 bases upper or lowercase, like this (Brown) profile:

TTGGGGAACCCCGGGGGGNNTTTT

Uncalled alleles must be entered as n or N (see above example).