USC The Snipper 4
app suite

AIM classification of individuals
with an Excel file of populations (.xlsx format)


Step 1: Data input (population)

Drag and drop on the button, or select the local Excel population file to upload, whichever suits you best. You can download a valid example file if necessary to clarify ideas, or use the input file generator wizard.

Step 2: Choose classifier

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)

Multinomial logistic regression

Genetic distance algorithm (allele and genotype frequency versions)

Step 3: Data input (individual)

Type the SNPs/Indels of the individual to classify in the area below. For instance, in the case of 32 SNPs we would expect you to type 64 bases upper or lowercase, something in the neighbourhood of

TTCCCTTTGGAACCCCAATTAAAATTCCAATTAACCAGGGCCAACCAAGGATCCATAGTTCCAC

Another example: in the case of the above Excel example file snipperfile.xlsx, we would expect you to type 24 bases upper or lowercase, like this Brown profile:

TTGGGGAACCCCGGGGGGNNTTTT

Uncalled alleles must be entered as n or N (see above example).




BBEdit Apache HTML5 R language Apple Inc.