Step 1: Choose population number

2 populations (fair or dark hair)

4 populations (red, blond, brown, or black hair)

Step 2: Choose whether to consider rs1129038-12913832 haplotype

Yes

No

Step 3: Choose classifier

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)

Genetic distance algorithm (allele and genotype frequency versions)

Step 4: Data input

Type 12 markers of the individual to classify as appropriate. For instance, the following 12 marker profile would be valid in the case of 2 or 4 populations, regardless of whether the rs1129038-12913832 haplotype is being considered or not:

AAGGGGCGCCGGGGGGAAAATTTT

Bases can be upper or lowercase. Blanks will be removed. Uncalled alleles must be entered as n or N.