Step 1: Data input (population)

Drag and drop on the button, or select the local Excel population file to upload, whichever suits you best (training-set-only file is required). The file must contain haplotype information in row 3. You can download a valid example file if necessary to clarify ideas, or use the input file generator wizard.

Step 2: Choose classifier

Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Step 3: Data input (individual)

Type the markers of the individual to classify in the area below. For instance, in the case of 32 SNPs we would expect you to type 64 bases upper or lowercase, something in the neighbourhood of

TTCCCTTTGGAACCCCAATTAAAATTCCAATTAACCAGGGCCAACCAAGGATCCATAGTTCCAC

TTGGGGAACCCCGGGGGGNNTTTT

Uncalled alleles must be entered as n or N (see above example).