USC The Snipper 4
app suite

Classification as individual having
blue-greenhazel-brown eyes


Step 1: Choose marker number

7 markers

13 markers

23 markers

Step 2: Choose whether to consider rs1129038-12913832 haplotype

Yes

No

Step 3: Choose classifier

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)

Multinomial logistic regression

Genetic distance algorithm (allele and genotype frequency versions)

Step 4: Data input

Type the required markers of the individual to classify as appropriate. For instance, the following profiles (Blue, Greenhazel, Brown, respectively) would be valid in the case of 7, 13 and 23 markers, respectively, regardless of whether the rs1129038-12913832 haplotype is being considered or not:

GGAGCCAAGGCGCC

AGAGCTCCACAGTTCCCCGGGGCCGG

AAGGGGCCCTGGACGGAGGGCTCCCCCCTTAGGTAAACCCTTAGAG

Bases can be upper or lowercase. Blanks will be removed. Uncalled alleles must be entered as n or N.




BBEdit The ASF HTML5 php 8 CSS R language Apple Inc.