Eye classifier

Home
Snipper papers
Reference set tools
Europe-East Asia-Africa-America-Oceania classification Black-intermediate-white skin classification Fair-dark or red-blond-brown-black hair classification Blue-greenhazel-brown eye classification 32 STR classification Europe-East Asia-Africa-America-Oceania Marker Panels Skin, Hair and Eye Marker Panels Download forensic MPS AIMs Panel Reference Population Sets
Custom set tools
Single profile classification Multiple profile classification Single profile haplotype classification Multiple profile haplotype classification Multiple profile general classification Classification using frequencies Population data analysis Offline tools Training/testing set design Snipper↔STRUCTURE file converter
Age tools
Blood, 7 CpGs, EpiTYPER (18-104 years) Blood, 7 CpGs, EpiTYPER (2-104 years) Semen, 3 CpGs, SNaPshot Tissue combined (blood & buccal & saliva), 5 CpGs, SNaPshot Blood, 5 CpGs, SNaPshot Buccal swab, 5 CpGs, SNaPshot Saliva, 5 CpGs, SNaPshot Saliva/Buccal swab, 7 CpGs, SNaPshot Cartilage, 3 CpGs, MiSeq
Tissue tool
Help
Snipper manual Excel input file generator Profile generator
About

Classification as individual having
blue-greenhazel-brown eyes

Step 1: Choose marker number

7 markers

13 markers

23 markers

Step 2: Choose whether to consider rs1129038-12913832 haplotype

Yes

Step 3: Choose classifier

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)

Multinomial logistic regression

Genetic distance algorithm (allele and genotype frequency versions)

Step 4: Data input

Type the required markers of the individual to classify as appropriate. For instance, the following profiles would be valid in the case of 7, 13 and 23 markers, respectively, regardless of whether the rs1129038-12913832 haplotype is being considered or not:

GGAGCCAAGGCGCC

AGAGCTCCACAGTTCCCCGGGGCCGG

AAGGGGCCCTGGACGGAGGGCTCCCCCCTTAGGTAAACCCTTAGAG

Bases can be upper or lowercase. Blanks will be removed. Uncalled alleles must be entered as n or N.