Step 1: Choose marker set

34-plex (previous) with rs727811 (toggle between marker list or marker table).

34-plex (revised) with rs3827760 (toggle between marker list or marker table).

46-plex AIM-Indels (toggle between marker list or marker table).

80-plex AIM-Indels (all of the above) (toggle between marker list or marker table).

Step 2: Choose populations

3 populations (Europe, East Asia, Africa).

4 populations (Europe, East Asia, Africa, America).

5 populations (Europe, East Asia, Africa, America, Oceania).

Step 3: Choose classifier

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)

Multinomial logistic regression

Genetic distance algorithm (allele and genotype frequency versions)

Step 4: Data input

Type either 34 SNPs or/and 46 AIM-Indels of the individual to classify as appropriate. For the required SNP/Indel (rs) numbers, see graphics on left. For instance, the following 34 SNP profile would be valid in the case of 34-plex (previous) with rs727811, and 3 populations:

AAAACTGGCCAATTCCAACCCCAGTTGGAAAAAGCCTTTTGGTTCCCTCGCCAGACTTCCCTGTCCAG

CCACCCCCAACCCCCCCCAACCCCCCACCCACAAAACCCCAACCAAA CCCCCCCCCCCCCAAAAAAACCCAACCACACCCCCCCACAACCAC

34 SNPs or/and 46 AIM-Indels for each individual as makes sense, 68 or 92 or 160 bases upper or lowercase.

Blanks will be removed. Gaps must be entered as n or N.