The Snipper 3.5
app suite
Classification as individual having fair-dark or red-blond-brown-black hair
Step 1: Choose populations
2 populations (fair or dark hair), rs1129038-12913832 haplotype
2 populations (fair or dark hair), no haplotype
4 populations (red, blond, brown, or black hair), rs1129038-12913832 haplotype
4 populations (red, blond, brown, or black hair), no haplotype
Step 2: Choose classifier
Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)
Multinomial logistic regression
Genetic distance algorithm (allele and genotype frequency versions)
Step 3: Data input
Type 12 markers of the individual to classify as appropriate. This is the list of required rs-numbers:
-rs1129038, rs11547464, rs12913832, rs12931267, rs1805006, -rs1805007, -rs1805008, rs1805009, rs28777, rs35264875, -rs4778138, -rs7495174.
Minus stands for reverse direction, see left-hand graphic for more details on the markers. For instance, the following 12 marker profile would be valid in the case of 2 or 4 populations, regardless of whether the rs1129038-12913832 haplotype is being considered or not:
AAGGGGCGCCGGGGGGAAAATTTT
Bases can be upper or lowercase. Blanks will be removed. Gaps must be entered as n or N.