Step 1: Data input (population)

Select your local Excel file of populations in the required format (training set file including microhaplotype information in row 3). You can download a valid example file if necessary to clarify ideas.

You can also construct your training set file using the input file generator wizard.

Step 2: Choose classifier

Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Step 3: Data input (individual)

Type the SNPs/Indels of the individual to classify in the area below. For instance, in the case of 32 SNPs we would expect you to type 64 bases upper or lowercase, something in the neighbourhood of

TTCCCTTTGGAACCCCAATTAAAATTCCAATTAACCAGGGCCAACCAAGGATCCATAGTTCCAC

TTGGGGAACCCCGGGGGGNNTTTT

Gaps must be entered as n or N (see above example).