The Snipper 3.5
app suite
Excel format required
Help interpreting results?
AIM classification of individuals with an Excel file of populations (.xlsx format)
Step 1: Data input (population)
Drag and drop or select the local Excel population file to upload, whichever suits you best. You can download a valid example file if necessary to clarify ideas, or use the input file generator wizard.
Step 2: Choose classifier
Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)
Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)
Multinomial logistic regression
Genetic distance algorithm (allele and genotype frequency versions)
Step 3: Data input (individual)
Type the SNPs/Indels of the individual to classify in the area below. For instance, in the case of 32 SNPs we would expect you to type 64 bases upper or lowercase, something in the neighbourhood of
TTCCCTTTGGAACCCCAATTAAAATTCCAATTAACCAGGGCCAACCAAGGATCCATAGTTCCAC
TTGGGGAACCCCGGGGGGNNTTTT
Gaps must be entered as n or N (see above example).