The Snipper 3
app suite
Excel format required
Help interpreting results?
AIM-microhaplotype classification of individuals with an Excel file of populations (.xlsx format)
Step 1: Data input (population)
Drag and drop or select the local Excel population file to upload, whichever suits you best (training set file including microhaplotype information in row 3 is required). You can download a valid example file if necessary to clarify ideas.
You can also construct your training set file using the input file generator wizard.
Step 2: Choose classifier
Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)
Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)
Step 3: Data input (individual)
Type the SNPs/Indels of the individual to classify in the area below. For instance, in the case of 32 SNPs we would expect you to type 64 bases upper or lowercase, something in the neighbourhood of
TTCCCTTTGGAACCCCAATTAAAATTCCAATTAACCAGGGCCAACCAAGGATCCATAGTTCCAC
TTGGGGAACCCCGGGGGGNNTTTT
Gaps must be entered as n or N (see above example).