Step 1: Choose classifier

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Multinomial logistic regression

Genetic distance algorithm (allele and genotype frequency versions)

Step 2: Data input

Type 10 markers of the individual to classify as appropriate. This is the list of required rs-numbers:

rs10777129, rs13289, -rs1408799, rs1426654, rs1448484, -rs16891982, rs2402130, -rs3829241, rs6058017, rs6119471.

Minus stands for reverse direction, see left-hand graphic for more details on the markers. For instance, the following 10 marker profile would be valid:

GGGCGGAAAACCAACCAAGC

Bases can be upper or lowercase. Blanks will be removed. Gaps must be entered as n or N.