Step 1: Choose populations

2 populations (fair or dark hair), rs1129038-12913832 haplotype

2 populations (fair or dark hair), no haplotype

4 populations (red, blond, brown, or black hair), rs1129038-12913832 haplotype

4 populations (red, blond, brown, or black hair), no haplotype

Step 2: Choose classifier

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Multinomial logistic regression

Genetic distance algorithm (allele and genotype frequency versions)

Step 3: Data input

Type 12 markers of the individual to classify as appropriate. This is the list of required rs-numbers:

-rs1129038, rs11547464, rs12913832, rs12931267, rs1805006, -rs1805007, -rs1805008, rs1805009, rs28777, rs35264875, -rs4778138, -rs7495174.

Minus stands for reverse direction, see left-hand graphic for more details on the markers. For instance, the following 12 marker profile would be valid in the case of 2 or 4 populations, regardless of whether the rs1129038-12913832 haplotype is being considered or not:

AAGGGGCGCCGGGGGGAAAATTTT

Bases can be upper or lowercase. Blanks will be removed. Gaps must be entered as n or N.