The Snipper 3.5

app suite


Eye colours


Help interpreting results?

Classification as individual having
blue-greenhazel-brown eyes


Step 1: Choose markers

7 markers, rs1129038-12913832 haplotype (toggle between marker list or marker table)

7 markers, no haplotype (toggle between marker list or marker table)

13 markers, rs1129038-12913832 haplotype (toggle between marker list or marker table)

13 markers, no haplotype (toggle between marker list or marker table)

23 markers, rs1129038-12913832 haplotype (toggle between marker list or marker table)

23 markers, no haplotype (toggle between marker list or marker table)

Step 2: Choose classifier

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Multinomial logistic regression

Genetic distance algorithm (allele and genotype frequency versions)

Step 3: Data input

Type the required markers of the individual to classify as appropriate. For the required (rs) numbers, see graphic on left. For instance, the following profiles would be valid in the case of 7, 13 and 23 markers, respectively, regardless of whether the rs1129038-12913832 haplotype is being considered or not:

GGAGCCAAGGCGCC

AGAGCTCCACAGTTCCCCGGGGCCGG

AAGGGGCCCTGGACGGAGGGCTCCCCCCTTAGGTAAACCCTTAGAG

Bases can be upper or lowercase. Blanks will be removed. Gaps must be entered as n or N.