Step 1: Data input (population)

Select your local Excel file of populations in the required format. You can download a valid example file if necessary to clarify ideas, or use the input file generator wizard.

Step 2: Choose classifier

Naive Bayes with allele frequencies (Hardy-Weinberg principle applies)

Naive Bayes with genotype frequencies (Hardy-Weinberg principle need not apply)

Multinomial logistic regression

Genetic distance algorithm (allele and genotype frequency versions)

Step 3: Data input (individual)

Type the SNPs/Indels of the individual to classify in the area below. For instance, in the case of 32 SNPs we would expect you to type 64 bases upper or lowercase, something in the neighbourhood of

TTCCCTTTGGAACCCCAATTAAAATTCCAATTAACCAGGGCCAACCAAGGATCCATAGTTCCAC

TTGGGGAACCCCGGGGGGNNTTTT

Gaps must be entered as n or N (see above example).